epsA [2019-07-12 10:51:54]

extracellular polysaccharide synthesis, putative transmembrane modulator of EpsB activity, might activate EpsB autophosphorylation and substrate phosphorylation

Locus: BSU34370

Isoelectric point: 6.07

Molecular weight: 25.75 kDa

Protein length: 234 aa

Gene length: 705 bp

Function: biofilm formation

Product: unknown

Essential: no

Synonyms: yveK

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Matrix polysaccharide synthesis
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,529,151 → 3,529,855

The protein

Protein family

• CapA family (with CapA and EpsA, according to UniProt)
• CpsC/CapA family (with TkmA, according to UniProt)

Paralogous protein(s)

• TkmA

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • RemA: activation, PubMed, in RemA regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • SinR: anti-activation, (prevents binding of RemA) PubMed, in SinR regulon
  • EAR riboswitch: processive antitermination, in EAR riboswitch

  Regulation

  • repressed by SinR PubMed

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed
  • expression is increased in rsiX mutants PubMed

Biological materials

Mutant

• MGNA-A073 (yveK::erm), available at the NBRP B. subtilis, Japan
• GP1517 (aphA3) PubMed, available in Jörg Stülke's lab
• GP1519 (epsA-epsB, aphA3) PubMed, available in Jörg Stülke's lab
• GP1567 epsA::aphA3 tkmA::spc PubMed, available in Jörg Stülke's lab
• BKE34370 (ΔepsA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTATTCATAGCCTTCAG, downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
• BKK34370 (ΔepsA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTATTCATAGCCTTCAG, downstream forward: _UP4_AAACATTTCGGGGAGTGAAG

GFP fusion

• GP1569 epsA-gfp (spc), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) PubMed, available in Jörg Stülke's lab

FLAG-tag construct

• GP1526 epsA-FLAG 3x spc (based on pGP1331) PubMed, available in Jörg Stülke's lab

Antibody

• **

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Reviews

Loading

Original publications

Loading